| Formulation having mobilizing activity |
Method of increasing the amount of stem cells and progenitor cells in the peripheral blood of a mammal; the method is characterized by the administration of Defibrotide in combination or in temporal proximity with at least one hematopoietic factor (G-CSF) having the capacity to mobilize hematopoietic progenitors. The present inventions also refer to the related pharmaceutical formulations containing thereof. |
| A method for determining the biological activity of Defibrotide |
An enzymatic method for determining the biological activity of Defibrotide is described. This method, which is based on the capacity of Defibrotide to potentiate the enzymatic activity of plasmin, comprises the steps of: (a) bringing into contact Defibrotide, plasmin, and a substrate specific for the plasmin which, by reaction with the plasmin, provides a measurable product and (b) measuring the amount of product formed at successive times. |
| DNA-based aptamers for human cathepsin G |
Non-peptidic inhibitors of cathepsin G, characterized by high levels of selectivity and which can be efficaciously used in the treatment and prophylaxis of inflammatory occurrences and procoagulant conditions. The cathepsin G-inhibiting aptamers of the present invention consist of linear DNA or polynucleotide sequences having a chain length of at least 60 nucleotides and being substantially not subjected to undergo efficient base pairing. |
| Formulation with anti-tumor action |
A method for treating a mammalian affected by a tumor, said method comprising administering to said mammalian and effective amount of Defibrotide alone or in combination with at least another active ingredient with anti-tumor action. The present invention also refers to the related pharmaceutical compositions containing Defibrotide and at least another active ingredient with an anti-tumor action (for example paclitaxel, monocrotaline, BCNU and/or cyclophosphamide). |
| A process for obtaining chemically defined and reproducible polydeoxyribonucleotides |
By carrying out the depolymerization of stabilized solutions of highly polymerized and nicked polydeoxyribonucleotides, as obtained through stabilizing aggregation of raw nucleic acids, the depolymerization being carried out by heating at controlled temperature and being controlled as function of the variation of the reversible hyperchromicity, followed by the removal of the hydrogen bonds in the double stranded filaments and by thermal stabilization of the single stranded filaments, the polydeoxyribonucleotides, known as Defibrotide, has the following formula of random sequence: P1-5,(dAp)12-24,(dGp)10-20,(dTo) 13-26,(dCp)10-20, wherein P is phosphoric radical, dAp is deoxycytidylic monomer and has well defined chemical-physical properties, reproducible in the industrial production. |
| Stable aqueous suspension of Mesalazine |
A pharmaceutical composition in the form of an aqueous suspension, comprising Mesalazine colloidal cellulose in an amount between 1.2 to 1.6% w/w. |
| Cathepsin G – inhibiting aptamers |
Cathepsin G-inhibiting aptamers comprising oligonucleotides selected from the group consisting of the consensus sequences: GGN1-7GGN8-14GGN1-6GGN1-7GGN1-6GG, GGN10-13GGN1-5GGN1-5GGN3-6GGN2-7GG and the sequence GGGTTGAGGGTGGATTACGCCACGTGGAGCTCGGATCCACACATCCAGG, wherein N represents nucleotides and the figures represent the number of possible nucleotides at that site, said cathepsin G-inhibiting aptamers are suggested as medicament. |
| Use of Sulglicotide of the treatment of the mucositis |
|
| Oligodeoxyribonucleotides having anti-ischemic activity and methods of preparation |
New oligodeoxyribonucleotides of animal origin, having a molecular weight comprised between 4,00 and 10,000 daltons, that can be obtained by fractionation of polydeoxyribonucleotides or otherwise by chemical or enzymatic depolymerization of high molecular weight deoxyribonucleic acids. The new compounds are endowed with a significant anti-ischemic activity. |
| Use of complex among cationic liposomes and polydeoxyribonucleotides as medicaments |
Use as medicament, specifically as anti-inflammatory, of complexes formed by cationic liposomes and polydeoxyribonucleotides having a molecular weight in the range 7,000-60,000 daltons, obtainable by depolymerization of nucleic acids, wherein in said complexes the polydeoxyribonucleotides are located on an outer surface of the liposome. |
| Pharmaceutical formulation having anti-tumor activity |
|